Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:138 nt.     Distance to run of Ts=1 nt.   Size=24 nt.     Delta G= -6.00 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -8.00 kcal/mol
Anti-antiterminator:   Size=17 nt.     Delta G= -6.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGTGGCTGATTTCTGTGGTCGGAAGCTATGAGCTTTCTCACATCGAAAACAGTTATAT
GACGGTATCGGCGTGATTGATACGTGACGTCTGCCCGTGGACGCGGCATATCCCTCTC
GGAAAACAATGACTCCGTCATGTCCATTTCTTGGTTTGACATGTTTTCGTTTGCAGCG
TCGGTGCTCACCACGGTGACCGCGGCGTTCGAGTCGCCGGGCAGGGCCTCGACCGAGG
GTCTCATcctcggctgagatgtgggcggtactatggattcttatcgataaggttcgtgatatgcggagATG

    BL0610


Gene: BL0610     GI: 23465195     BI number: BL0610     GOG: COG1609     Description: LacI-type transcriptional regulato


            C
          T  T
          C  C
           CG
           CG
           TA
          |  A
          |  A
          |  A
          |  C
          A  A
           TA
           AT
           CG
          |  A
          |  C        T
          |  T      T  C
           GC       T  T
           GC        AT
 GG        CG        CG
T  A       GT        CG
 GC       |  C      T  T
 CG       |  A      G  T
|  C      |  T      T  |
 CG        CG        AT
 CG        AT        CG
 GC        GC        TA
 TA        GC        GC
                        ATGTTTTCGTTTGCAGCGTCGGTGCTCACCACGGTGACCGCGGCGTTCGAGTCGCCGGGCAGGGCCTCGACCGAGGGTCTCATcctcggctgagatgtgggcggtactatggattcttatcgataaggttcgtgatatgcggagATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[K] COG1609 Transcriptional regulators ... can be seen here

    ..................................................................................................................