Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:3 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-20.90 kcal/mol
Antiterminator: Size=66 nt.     Delta G=-10.47 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G=-11.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGGTAAATCACGAACCAAAAACGTGGCTGTTCCTCGTCAGATCGCCATGTATCTGGC
TCGCGAAATGACCAGTATGAGCCTGATGGATATTGGCCAGGTCTTTGGCGGACGCGAT
CACACCACAGTAATGCATGCCTGCACTCGAATCAGTGACCGAATGCAGCAAAAACAGG
AGATCTATAACTACGTTATGGAGCTCACGGTTCGCCTCAAGCAAAGCAACACCAACTG
AcacaacgcttctgagagacgaaaaacggcactttttggactgactttccgaaaagtgccgtttttggTTG

    BL0639


Gene: BL0639     GI: 23465222     BI number: BL0639     GOG: -------     Description: hypothetical protei


           CT
          A  G
          A  A
          C  c
          C  a
          A  c
          C  a
          A  a
          A  c
           Cg
           Gc
           At
           At
          |  c
           At
  A        Cg
T  C      G  a
 CG       A  |        a
 AT       A  |      g  c
 AT        Cg       t  t
 TA        Ta       c  t
 AT        Cg        at
 TG       C  a       gc
 CG        Gc        gc
 TA        Cg        tg
A  G       Ta        ta
 GC        Ta        ta
 AT       G  a       ta
 GC       G  a       ta
|  A      C  a       cg
G  C      A  c       at
A  G      C  |       cg
 CG        Tg        gc
 AT        Cg        gc
 AT        Gc        cg
                        tttttggTTG


    ..................................................................................................................