                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:93 nt.    Distance to gene:121 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-23.32 kcal/mol
Antiterminator:    Distance from promoter:81 nt. Size=23 nt.     Delta G=-12.50 kcal/mol
Anti-antiterminator:    Distance from promoter:48 nt.    Size=47 nt.     Delta G=-22.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: atgata-tataat. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atgatacgtagacttttctacgcatataattcttaccttgggtaagtactccaggagccttcccccaactatgggcttcctggaatgagggcggagcgtc
ccccaaccagctccgcgccttcaggggggcgggaacatccccttctctcccgccccctttttcttttctttttttgagctcagaacaatctgacgagcag
gaatggtgacggtggccggtgaaaccgcagtatgggccggaacaaccgttacgatgggtggcgtaatcgttcatccagcaggaagagtATG

    BL0658 --- ksgA --- ispE Gene: BL0658     GI: 23465241     BI number: BL0658     GOG: COG3583     Description: narrowly conserved hypothetical protein Gene: ksgA     GI: 23465240     BI number: BL0657     GOG: COG0030     Description: dimethyladenosine transferase ribosomal RNA adenine dimethylase Gene: ispE     GI: 23465239     BI number: BL0656     GOG: COG1947     Description: 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase; Cmk; 4-(cytidine-5'-diphospho)-2-C-methyl-D-erythritol kinas cc c  a c  a c  c t  c g  a cg gc at                   c gc                 c  c gc                 c  t cg                 t  t gc                 a  c |  g                c  t gc        ag       a  c gc       c  g       at at        tg        gc gt        tg        gc t  |       cg        gc a  |       cg        cg a  |       gc        gc g  |       cg        gc gc       g  |       gc ta        cg        gc cg        cg        gc cg        ta        gt                         ttttcttttctttttttgagctcagaacaatctgacgagcaggaatggtgacggtggccggtgaaaccgcagtatgggccggaacaaccgttacgatgggtggcgtaatcgttcatccagcaggaagagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3583 Uncharacterized protein conserved in bacteria ... can be seen here [J] COG0030 Dimethyladenosine transferase (rRNA methylation) ... can be seen here [I] COG1947 4-diphosphocytidyl-2C-methyl-D-erythritol 2-phosphate synthase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_longum                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:95 nt.    Distance to gene:128 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-18.42 kcal/mol Antiterminator:    Distance from promoter:58 nt. Size=23 nt.     Delta G=-12.50 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: atgata-tataat. It has a score value of 60.91 and is shown in blue Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case atgatacgtagacttttctacgcatataattcttaccttgggtaagtactccaggagccttcccccaactatgggcttcctggaatgagggcggagcgtc ccccaaccagctccgcgccttcaggggggcgggaacatccccttctctcccgccccctttttcttttctttttttgagctcagaacaatctgacgagcag gaatggtgacggtggccggtgaaaccgcagtatgggccggaacaaccgttacgatgggtggcgtaatcgttcatccagcaggaagagtATG     BL0658 --- ksgA --- ispE Gene: BL0658     GI: 23465241     BI number: BL0658     GOG: COG3583     Description: narrowly conserved hypothetical protein Gene: ksgA     GI: 23465240     BI number: BL0657     GOG: COG0030     Description: dimethyladenosine transferase ribosomal RNA adenine dimethylase Gene: ispE     GI: 23465239     BI number: BL0656     GOG: COG1947     Description: 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase; Cmk; 4-(cytidine-5'-diphospho)-2-C-methyl-D-erythritol kinas             c           c  c           c  t           t  t cc       a  c t  c      c  t gc       a  c cc        at ga        gc aa        gc gc        gc gc        cg c  |       gc ga        gc gg        gc gc        gc             ctttttcttttctttttttgagctcagaacaatctgacgagcaggaatggtgacggtggccggtgaaaccgcagtatgggccggaacaaccgttacgatgggtggcgtaatcgttcatccagcaggaagagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3583 Uncharacterized protein conserved in bacteria ... can be seen here [J] COG0030 Dimethyladenosine transferase (rRNA methylation) ... can be seen here [I] COG1947 4-diphosphocytidyl-2C-methyl-D-erythritol 2-phosphate synthase ... can be seen here     ..................................................................................................................