Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:94 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-10.00 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-14.94 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAGGCTATTGCAACATCAGCCAATCCCGAAATCGACCTATTGCGCGAGGAAGTGCGTG
AGCTGACCGCTACGGTAGCCGGTCTGCGCACCGAACTTGAGCGACGTTGAttggcgaagcggg
acaaacaacgattctgccaagaaggtccgcgtcagttgttgtcaccgcggattgcggcagaatcattgtcgccacggctgttttcttcagtcggctcaac
ccaacttttgataatttttatttttttgatatttttgataatttttattttaggttgattcagcgaggaggcggtccacATG

    BL0662


Gene: BL0662     GI: 23465245     BI number: BL0662     GOG: NOG27054     Description: hypothetical protei



 gt
t  t
t  g
g  t
a  c
c  a        t
t  c      a  c
 gc       a  a
 cg        gt
 gc        at
 cg        cg
 cg        gt
 ta        gc
 gt        cg
 gt        gc
a  g      |  c
a  c      |  a
g  |      t  c
a  |      t  g
a  |      a  g
 cg        gc
 cg        gt
 gc        cg
 ta        gt
            tttcttcagtcggctcaacccaacttttgataatttttatttttttgatatttttgataatttttattttaggttgattcagcgaggaggcggtccacATG


    ..................................................................................................................