                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:164 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-23.00 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -4.80 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G=-17.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttgcaccatCGGGCCGTAGCGCAGTTTGGTAGCGCACTTGACTGGGGGTCAAGGGGTCGCG
GGTTCAAATCCCGCCGGCCCGACCGattagccccggaattctgccacttttgagtggttgtcttccggggtttttccgtttt
cagacaatatgagacaacatgacgacggacttacctttgtaagccattcgtaatgaattatcaccgacaattcaccgcctccgcacccccgtcgtatgcg
tttgccccaaacaggggctagactggttcctattgatttgacgaaagggacccgaaTTG

    Pro Gene: ugpA     GI: 23465317     BI number: BL0739     GOG: COG4284     Description: probable UTP-glucose-1-phosphate uridylyltransferas                      tt                     t  g                      ta            ag        cg           t  c       at   A       t  c       cg C  A      a  c       cg T  A       Gc        gt T  T       Cg       t  t GC        Cg       c  g GC       |  a      t  t GC       |  a      t  c CG       |  t       at |  C       At        at GC        Gc        gc CG       C  t       gc TG       C  |       cg GC        Cg        cg GC        Gc        cg GC        Gc        cg                         tttttccgttttcagacaatatgagacaacatgacgacggacttacctttgtaagccattcgtaatgaattatcaccgacaattcaccgcctccgcacccccgtcgtatgcgtttgccccaaacaggggctagactggttcctattgatttgacgaaagggacccgaaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG4284 UDP-glucose pyrophosphorylase ... can be seen here     ..................................................................................................................