Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:181 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -8.30 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-15.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCGATTGAACCTGGGAACACAGCTCGATGCGCTCTACGACCGGCCTCATAAGGAGAT
AACCAACGAGGGCGGCACGCTGATCATCATCCATGATGCCGATTCCTCGGAATGGCAT
ttcttcgaatgcctcgtctgaaagctgagcactcccgaaacatatgcgattgtcctgaagaagagcccagaccaaccaagccccgattatccagataaaa
aagaaacccccagtgcatcacggctgagtcgaagaccgtccggagaggccctttgggggaattcttgatatatcataatgagccATG

    BL0768


Gene: BL0768     GI: 23465344     BI number: BL0768     GOG: NOG40877     Description: hypothetical protei



 AT
C  C
 TA
 AT
 GC
T  C
C  A
 GT
 CG
|  A
 AT
 CG
 GC        TC
 GC       C  G
 CG        CG
|  A       TA
|  T       TA
G  T       AT
 GC       G  |
 GC        CG
 AT        CG
 GC        GC
 CG        TA
            TttcttcgaatgcctcgtctgaaagctgagcactcccgaaacatatgcgattgtcctgaagaagagcccagaccaaccaagccccgattatccagataaaaaagaaacccccagtgcatcacggctgagtcgaagaccgtccggagaggccctttgggggaattcttgatatatcataatgagccATG
    ..................................................................................................................