                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:36 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=24 nt.     Delta G= -6.20 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-10.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAAGCCATGCTCGGTTTGTGTGGAGCCGCCGGCAACCAGCTGATCGGTGATCTTCTTG
CCCTTGCGGTCGGTGAACTGCACCTTCTCGCCTGCGGTCAGCGCCCCGCGCCTCGGCC
CCATgattgctccttgcgtgttcttggtcggtcaaacgatacaagtctaatgcatgtaagaatgcatgtaagctcgttgagtgaggtgatgacgatg
cgactgcagatgacgagccgaatcaatgccggcggcgacgacccggttttcttgatgtttcacgggtatggcaacgatgagagcgaaATG

    BL0801 Gene: BL0801     GI: 23465377     BI number: BL0801     GOG: -------     Description: hypothetical protein with carboxyesterase/lipase domai cg a  a g  t t  g a  c g  g ta gc gt a  g        a gc       c  a ta       t  t       cg g  g      a  g      g  a a  a      a  c       gc gt        gc        cg tg        cg       |  a ta        cg       |  c gc        gc        gc cg       |  g       gc ta       a  g       cg cg        gc        cg gc        cg        gt                         tttcttgatgtttcacgggtatggcaacgatgagagcgaaATG     ..................................................................................................................