Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G=-16.60 kcal/mol
Antiterminator: Size=76 nt.     Delta G=-23.45 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G=-10.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGAGCGGTTCCTTGATACCTTGGGCAATCCCGAAGATGAAGAACATGATGGCATGGT
TGAGTGGGCCGAGGACCAGATGTGGGATCGTTTCACGCTGAACCGCCATCGTGAGCGT
CTGTTCCGTTGGCACAAGCACCGTGACATGATGTTGCAGTAGatggcgtggctacaatatgagcagctg
tcagcggaatagccgtttgtggcttgcgggctaggggctgaaaatgctataaatatattgctttactcggaaacgagaaaggctccaagtcgccgggggg
ctcccccggcattttTTG

    BL0809


Gene: BL0809     GI: 23465384     BI number: BL0809     GOG: -------     Description: hypothetical protei


           aa
          g  a
           gc
           cg
           ta
           cg
          a  a
           ta
           ta
           tg
           cg
           gc
          t  t
          t  c
          a  c
          t  a
          a  |
          t  |
          a  |
          a  |
          a  |
          t  |
          a  |
          t  |
          c  |
          g  |
          t  |
  g       a  |
a  g      a  |
t  g      a  |
 cg       a  |
 gc       g  |
 gt        ta
g  g       cg
c  a       gt
g  a       gc
 ta       |  g
 ta        gc
|  t       gc         c
 cg       |  g      g  t
 gc       |  g       gc
 gt       |  g       gc
 ta       a  g       gc
 gt        tg        gc
 ta        cg        gc
 ta        gc        cg
 ta        gt        cg
 gt        gc        gc
                        attttTTG


    ..................................................................................................................