                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:173 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-18.80 kcal/mol
Antiterminator: Size=21 nt.     Delta G=-16.60 kcal/mol
Anti-antiterminator:   Size=37 nt.     Delta G=-11.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TACCAGTCCGTGCTCGACGAGCAGAAGAAGTAAgtagcgctgcaacgagtgcccccctcagtccggctgcgccggc
cagctcccctcagggaggggagccagaatattgtctcttggctccccttctttgaggggagctgtcaccgtaggtgactgaggggagtcctcagatcgcg
aatcatagttagcatttcactcatgacaaacaccgtcctccaactcgacaacgtcgaattccggcgtaaccgtcgtgtcattatcaccgacgtgaacctc
accatcaacgcgggggagcgttggGTG

    BL0825 Gene: BL0825     GI: 23465400     BI number: BL0825     GOG: COG1119     Description: probable ATP binding protein of ABC transporte cc g  g cg gc                  tt |  c                a  g ta                 t  t cg                 a  c gc                  at gt         g        gc c  c      a  g      |  t c  c       cg        at t  c       ta        cg gc        cg        cg at        cg        gc c  c       cg        at ta        cg        gc cg        ta        gc cg        cg        gc cg        gc        gc                         ttctttgaggggagctgtcaccgtaggtgactgaggggagtcctcagatcgcgaatcatagttagcatttcactcatgacaaacaccgtcctccaactcgacaacgtcgaattccggcgtaaccgtcgtgtcattatcaccgacgtgaacctcaccatcaacgcgggggagcgttggGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1119 ABC-type molybdenum transport system, ATPase component/photorepair protein PhrA ... can be seen here     ..................................................................................................................