                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:68 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-16.30 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -5.90 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-15.44 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATCGCCATCGCGATTATCGCGTTCTTCGTGGTTATGTGGCTGCCAAGCCATCCGATG
TGGCTGATCATCACCGTTTCCGCGGTGTTCATTGTGGGTGTGCTGAGCCTGTTCTTTA
CGGCTGGCGATTCCAAGCATAATCCGAATTTGGATCAGAACGGCACGGCAGTCTGAtc
ttttgcctggtaaatccggcttgaaaagcaaaacgcacgacggaagttgtgcgttttcttgtatgcggtgccctaaagtaagaagtgcttgagtttcttt
ctgacgcacgaaggagaggcagtccgATG

    glgA Gene: glgA     GI: 23465401     BI number: BL0826     GOG: COG0438     Description: possible glycosyltransferas   C A  G CG GC G  A C  G A  | AT GC         a AT       a  a CG       t  t TA        gc At        gc Gc        tg Gt        cg T  t      |  c T  t      |  t T  |      |  t A  |      |  g A  |      |  a G  |      |  a C  |      |  a C  |      |  a T  |       cg        ga A  |       gc       g  a A  |       ta        cg T  |       ta        at At        ta        gt Cg        ta        cg Gc       c  c       at A  c      t  g       cg At       A  |       gc Cg        Gc        cg Cg        Ta        at                         tttcttgtatgcggtgccctaaagtaagaagtgcttgagtttctttctgacgcacgaaggagaggcagtccgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0438 Glycosyltransferase ... can be seen here     ..................................................................................................................