                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:123 nt.     Distance to run of Ts=1 nt.   Size=37 nt.     Delta G=-11.10 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-11.30 kcal/mol
Anti-antiterminator:   Size=60 nt.     Delta G=-13.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGGACCTCGGCATCGTGGTCGGCATTCTCAATCCCCTGAGCCATCGCCCGGGCCGCC
TCCATGGCGGTCAGGCTCTCTTTGAAGGAGTCAGGGGCGCATAAGTATCGCGTCATGC
TTCGAGCATACCGCACGACACGACGAAACGGTAAACGTTTTCCGTAATTCGCGTGATT
ATTTTTTTGTTCAGAATTCAGGCTTTCCAAtccacaatgctactattgcaagcaaaaatgcgatatcgttgcggtaaa
cgtttagacacgttttccgtttcagggaagaaaaggatcgattcgatcGTG

    BL0846 Gene: BL0846     GI: 23465420     BI number: BL0846     GOG: COG1609     Description: LacI-type transcriptional regulato   G A  T A  A T  T A  C CG GC CG GT GC G  A        A G  |      T  C AT       A  C CG        CG T  |       GC GC       A  A AT        GC        CG GT        CG       A  T GC        TA       A  T A  |      T  |      A  T A  |      C  |      T  T G  |       GC        GC T  |       TA        GC T  |      A  C       CG T  |       CG        AT C  |       TA       |  A T  |       GC       |  A CG        CG        AT TA       |  A       AT CG       |  A       GC GC       |  A       CG G  A       GC       A  | A  T       CG        GC C  |       TG        CG TA        AT        AT GC        TA        CG                         ATTATTTTTTTGTTCAGAATTCAGGCTTTCCAAtccacaatgctactattgcaagcaaaaatgcgatatcgttgcggtaaacgtttagacacgttttccgtttcagggaagaaaaggatcgattcgatcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1609 Transcriptional regulators ... can be seen here     ..................................................................................................................