                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:29 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G=-12.70 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-12.30 kcal/mol
Anti-antiterminator:   Size=17 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTGTTCACCGGGACGTCGTCGACCTGCGGGTCGAAAAGAAAAAGGGCATCAGTCATg
acttcaaggctacacgcgacacgccgggcacacgcgcgaattgcatccctgtaatttcatgctaagctatctactcgttgtccaaacgacacctGCCC
GGGTGGCGGAATGGTAGACGCGCTAGCTTGAGGTGCTAGTGCCTATTTTATACAGGCG
TACGGGTTCAAGTCCCGTCTCGGGCAcagataaaccccttgcattgcaaggggtttttcgttatctgcacacacgaaaggc
caccaATG

    Leu Gene: tnsR     GI: 23465439     BI number: BL0865     GOG: COG0566     Description: possible tRNA/rRNA methyltransferas             C           T  T            GC            CG            CG            CG           |  C            TA            Gc           |  a           |  g           A  a           A  t           C  a            Ta            Ta         t   A        Gc       a  t C  A       Gc        cg T  G       Gc        gc T  T      C  c       ta GC       A  t       ta GC       T  |       cg GC        Gt        cg CG        Cg        cg AT        Gc        cg                         tttttcgttatctgcacacacgaaaggccaccaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0566 rRNA methylases ... can be seen here     ..................................................................................................................