                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:38 nt.     Distance to run of Ts=1 nt.   Size=27 nt.     Delta G=-10.60 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -6.10 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-12.22 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGGGTGGAGAATTTATCAATCAGATAGCCTGAAATCGGCACCATGATGCCCGAGACC
AGCATGTAGACGCTGGTCACCCACTGCACGGTGCCGGTGGTGATATTGAAATCACGCA
TCAGTGCCGGCAAGGCCGGTGACATGACGGTCTGGTTGAGCAGCGCGATGAACGAGCC
GACGACGATCACACCCACAACGATGAATCGGGTGTGCGGATCAATAGGCTTTACGGAA
CTGGTGGCGGACCCGAGTTCCGCGTTTTTCTGTGAGGTCACagcatttccttctgttggtaacgtcatG
TG

    BL0921 Gene: BL0921     GI: 23465494     BI number: BL0921     GOG: -------     Description: hypothetical protei   A G  T C  G       AT A  A      A  A A  A       CG C  T       TG A  C      A  | CG        GC CG        GT CG       C  T AT        GT CG        TA AT        GC CG        TG         C T  |      |  G      G  G A  |      |  A      G  G G  |      G  A       TA C  |       GC        GC A  |       GT        GC G  |       CG       |  C C  |       TG       |  G A  |       AT        TA GC       A  G       CG CG       G  G       AT CG       T  |       AT G  A      A  |       GC AT        GC        GC GC        CG        CG                         CGTTTTTCTGTGAGGTCACagcatttccttctgttggtaacgtcatGTG     ..................................................................................................................