                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:198 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-17.00 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -6.90 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -9.29 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggggtgcatcgcgaatcatcgagccgcatggggtgccttccgtccgataacttgactcaaggagtagaaagctcgcactgacgtcatgcagtgcgggctt
tcttgcgtctgtatgcctcacactgtttgcgcagaggcatgaatagtgtgagacctgagacgacataatcctcaaggatgagggccggcgcgtggccgac
cgcccaattcagtctggcgcacgatggggcgcgccgttatttcttcataagttggaatcatcatccgggcataaggcccggcccaatatggagaggcatt
ATG

    BL0932 Gene: BL0932     GI: 23465505     BI number: BL0932     GOG: COG1136     Description: possible ATP binding protein of ABC transporte at         a c  g      a  g g  g       cg cg        ta cg        cg gt        at a  g      |  a g  c      |  g c  c      g  a t  t       ta a  t       ta c  c       cg t  c      a  c       tc a  g      a  |      g  a at       t  |      c  t gc        at       a  g c  |       gc        gc gc        cg        ta cg       |  c       cg ta       |  a       at at       |  c       cg c  a      |  t       gc g  |       cg        cg ta        ta        tg gc        gc        cg gt        cg        gc                         tttcttgcgtctgtatgcctcacactgtttgcgcagaggcatgaatagtgtgagacctgagacgacataatcctcaaggatgagggccggcgcgtggccgaccgcccaattcagtctggcgcacgatggggcgcgccgttatttcttcataagttggaatcatcatccgggcataaggcccggcccaatatggagaggcattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [V] COG1136 ABC-type antimicrobial peptide transport system, ATPase component ... can be seen here     ..................................................................................................................