                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:40 nt.     Distance to run of Ts=1 nt.   Size=29 nt.     Delta G=-24.20 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-12.90 kcal/mol
Anti-antiterminator:   Size=13 nt.     Delta G= -5.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGGCCTCTACCACGCGAACATCAACGTTCTGCGCAAGGAGACCATGGAGGACGCCGT
CGAGCACCCCGAAAAGTACCCGCACCTGACCGTGCGTGTCTCCGGCTACGCGGTGAAC
TTCGTCAAGCTCACCAAGGAGCAGCAGCTCGACGTCATCTCCCGTACCTTCCACCAGG
GTGCCGTCGTCGACTGAtgaccaaccccgcgaaccgcggcaatgactaactgaaggggtggggcacggctccaccccttccttatttc
ccacagactttcgcatcatttggaacaggaggacaacgATG

    BL0946 Gene: pflA     GI: 23465523     BI number: BL0950     GOG: COG1180     Description: pyruvate formate-lyase 1 activating enzym            ga           t  c           a  t           a  a           c  a            gc            gt            cg           |  a           g  a            cg            cg         c           a  g      a  g           a  |       cg           g  |       gc            cg        gt            gt        gc            cg        gc            cg        ta   a        cg        gc a  c       cg        gc gc       |  c       gc cg       a  a       gc gc       a  c       at cg        cg        at cg        cg        gc                         cttatttcccacagactttcgcatcatttggaacaggaggacaacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG1180 Pyruvate-formate lyase-activating enzyme ... can be seen here     ..................................................................................................................