                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:103 nt.     Distance to run of Ts=1 nt.   Size=32 nt.     Delta G=-24.00 kcal/mol

                                                                        Nomenclature/Definitions

CCAGGGCCCGAAGGAAGAGAAGCCGGTCGAGGAGACCTCCAACTACTCTTCCGCTGCT
CCGACTACCGGTACCCTCGCCGACTCCGATCAGCTCGCCGCCCTGCGCGACCAGCTGC
TCGGCAAGTGAgtttgccgcgaagctagcgcttagcgtgtaaagaaacccggtccgattgggccgggtttcttgtgtttttggagttatccg
ccaatgactcccctcagtctcgctacgcgagccggctcccctccctgaggggagctgtcggcgataaccggccgaggggagcgccagctatcATG

    BL0991 --- uvrB Gene: BL0991     GI: 23465560     BI number: BL0991     GOG: COG0237     Description: hypothetical protein in upf0038 Gene: uvrB     GI: 23465559     BI number: BL0990     GOG: COG0556     Description: excinuclease ABC subunit           at          g  t           cg           cg           tg           gc           gc           cg           cg           cg           at           at           at           gc           at           at             gtgtttttggagttatccgccaatgactcccctcagtctcgctacgcgagccggctcccctccctgaggggagctgtcggcgataaccggccgaggggagcgccagctatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0237 Dephospho-CoA kinase ... can be seen here [L] COG0556 Helicase subunit of the DNA excision repair complex ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_longum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:113 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-15.10 kcal/mol                                                                         Nomenclature/Definitions CCAGGGCCCGAAGGAAGAGAAGCCGGTCGAGGAGACCTCCAACTACTCTTCCGCTGCT CCGACTACCGGTACCCTCGCCGACTCCGATCAGCTCGCCGCCCTGCGCGACCAGCTGC TCGGCAAGTGAgtttgccgcgaagctagcgcttagcgtgtaaagaaacccggtccgattgggccgggtttcttgtgtttttggagttatccg ccaatgactcccctcagtctcgctacgcgagccggctcccctccctgaggggagctgtcggcgataaccggccgaggggagcgccagctatcATG     BL0991 --- uvrB Gene: BL0991     GI: 23465560     BI number: BL0991     GOG: COG0237     Description: hypothetical protein in upf0038 Gene: uvrB     GI: 23465559     BI number: BL0990     GOG: COG0556     Description: excinuclease ABC subunit           at          g  t           cg           cg           tg           gc           gc           cg           cg           cg             tttcttgtgtttttggagttatccgccaatgactcccctcagtctcgctacgcgagccggctcccctccctgaggggagctgtcggcgataaccggccgaggggagcgccagctatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0237 Dephospho-CoA kinase ... can be seen here [L] COG0556 Helicase subunit of the DNA excision repair complex ... can be seen here     ..................................................................................................................