Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:97 nt.     Distance to run of Ts=1 nt.   Size=29 nt.     Delta G=-11.40 kcal/mol
Antiterminator: Size=25 nt.     Delta G= -4.10 kcal/mol
Anti-antiterminator:   Size=74 nt.     Delta G=-16.55 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCAAcgcctgttcgcgcgcctcgatagccgcctgacgcttggatgcgatggtggcatcctctgcaatcgtcgcgctgttatgagcgtcgtgatgca
tcgtcttttccgagtcgccggttgttgatgccatggtgatgcccccgtttcacgagttgacgttacgcttcttacgctgccgtaacctacgttagcgtaa
cttttatgcttgtcaataccgactcgcgcgaacactatcacccaatggcggcgatactatggaatccgaagatgagaacgtcgcagcaataaagggctcg
gcgATG

    BL1013


Gene: BL1013     GI: 23465582     BI number: BL1013     GOG: -------     Description: hypothetical protei


  t
t  g
g  a
t  t
 tg
 gc
 gc
|  a
|  t
 cg
 cg
 gt
 cg
 ta
 gt
|  g
|  c
a  c
g  c
c  c
c  c
t  g
t  t
t  t
t  t
c  c
 ta                   c
 gc                 a  c
 cg        ta        at
 ta       t  c       ta
|  g      c  g       gc
|  t      t  c       cg
 at       t  t      c  t
 cg        cg        gt
|  a       gc        ta
 gc       |  c       cg
 tg        cg        gc
 at        at        cg
 gt        ta        at
 ta        ta        ta
 gc        gc        ta
                        cttttatgcttgtcaataccgactcgcgcgaacactatcacccaatggcggcgatactatggaatccgaagatgagaacgtcgcagcaataaagggctcggcgATG


    ..................................................................................................................