                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:52 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-10.60 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-12.76 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-19.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCATCAGCCCGCCAGTTTCGGCATCGGCGTGGGACAGGTCATCAAGGGCTGGGACCAG
ACTGTGCCGGGCCATAACGTGGGTTCGCGTCTGGTGGTTTCCATTCCGCCGGAATACG
GCTACGGTTCCCGCGGCATCCCGCAGGCCGGCATCGGCGGCGAGGACACGCTGGTGTT
CGTCATCGACATCATTTCCACCCGCTGAccataggtcagcacatgacgaacgccggggtcatagccggcgttttgtcat
aaataacgaagattgtttcagcatcgacaacggttcaggaggacgatATG

    greA Gene: greA     GI: 23465584     BI number: BL1015     GOG: COG0782     Description: transcription elongation factor Gre CA T  T        t GC       a  a CG        cg T  |       cg TA        At GC        Gc TA        Ta GT        Cg GC        Gc TA       |  a C  T      |  c G  T      |  a C  |      |  t A  |      |  g C  |      |  a AT       |  c GC       |  g GC       |  a A  A      |  a       ca G  C      |  c      t  t C  |      |  g      g  a GC       |  c      g  g GC       |  c       gc CG       |  g       gc GC        Cg        cg GT        Cg        cg CG        Cg        gc TA        At        cg                         ttttgtcataaataacgaagattgtttcagcatcgacaacggttcaggaggacgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0782 Transcription elongation factor ... can be seen here     ..................................................................................................................