                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:49 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-15.00 kcal/mol
Antiterminator: Size=49 nt.     Delta G= -8.62 kcal/mol
Anti-antiterminator:   Size=27 nt.     Delta G= -9.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGGCGGCGCGATGTTCCGCACCGTGCCGCTGCCGATCGACATGTGGCTGAAAATCAT
CGCGGTCGGTTTCGGCGTGGTGGTGCTGCAGGAAGTTATCAAGACCGTCAAGCGCGCA
GCCGCCGCCATCCGCGCGCGCCGCACGGCCAATGAAAGCGATTCCCAGCAACCGCACC
AGCCAATCGCTCTGGATCTGGTGGACTGAtaacacaccgataacggaaagagaccgacagattcctgtcggtctctttt
cattcgcggtcggacaaatgcgcggctagagttctttggctcggtagATG

    BL1039 Gene: BL1039     GI: 23465605     BI number: BL1039     GOG: -------     Description: hypothetical protei            ta           a  a            gc            cg            cg           a  a           c  a           a  a           c  g           a  |           a  |           t  |   G       A  | C  C      G  | T  T       Ta A  C       Cg AT       A  a       tt CG        Gc       a  c CG        Gc        gc |  A       Tg        at |  T      G  a       cg GC        Gc        at AT        Ta        gc CG        Cg        cg CG        Ta        cg AT        At        at CG        Gt        gc                         tcttttcattcgcggtcggacaaatgcgcggctagagttctttggctcggtagATG     ..................................................................................................................