                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:141 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -8.20 kcal/mol
Antiterminator: Size=62 nt.     Delta G=-19.10 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-15.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACTGTCGTAGTCTATTGTGCTCAAGGATGGTGGAGCGAGGAAGTAGCTGAAATCCTT
GCCGATCGCGGCTACGATGTAGCAAGCCTCGATGGCGGTTTTCAAGGTTATCTCGACT
ATCTTGAAACCCACCACGATTAAcggttcccgttgtcgttcttttggatgagtgtgcacggacatacgtgtgccctacaatcg
gtcacggtattactcgatggattcttgaatatcgccgggtaatcgtaattcacaacaggggattgcactgaaccaacccaaaacgggaaggaccgaaaat
cGTG

    BL1053 Gene: BL1053     GI: 23465620     BI number: BL1053     GOG: COG1418     Description: hypothetical protein in metal-dependent hydrolase famil            TC           C  G           T  A           A  C           T  T   G        TA T  T       GT A  A       GC G  G       AT C  C       AT A  A       CG TA        TA CG        TA GC        TA GC       T  C C  T       GC GC        GC CG       C  A TA        GC AT        GC |  G       TA |  G      A  |        t GC        GC       t  c CG        CG        gc CG        TA        gc |  T      |  T       cg |  T      |  T       At |  T      |  A       At |  T      |  A      T  | GC       |  c       Tg TA        Cg        At TA        Cg        Gc CG        Gt        Cg CG        At        At                         tcttttggatgagtgtgcacggacatacgtgtgccctacaatcggtcacggtattactcgatggattcttgaatatcgccgggtaatcgtaattcacaacaggggattgcactgaaccaacccaaaacgggaaggaccgaaaatcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1418 Predicted HD superfamily hydrolase ... can be seen here     ..................................................................................................................