                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:138 nt.     Distance to run of Ts=3 nt.   Size=29 nt.     Delta G=-10.50 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -5.10 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-13.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atgactgaggggagtacgagcaaagattatgctcgtgctcccctcgttttttttgccgatgacggaagaagctcagtgctctccgtaatgagttcggcag
acggctatttccaggttttgaacatcgttacccgtaatgcggtatacgatgcggttcttttcatcaatacgacgtgaccagtatccctgacattgccgcc
atggaatacgaacaacttgaatccaccggtatgtagcccaacgctgatagtctgacaagcagtctgatttgtttgcaatccatggtttcaaggagccttc
ATG

    argH Gene: argH     GI: 23465626     BI number: BL1057     GOG: COG0165     Description: argininosuccinate lyase; arginosuccinas ta g  a       gt c  t      g  t cg       a  t ta       c  t cg        cg |  t       ta |  t       ta |  c      t  c tg       a  a cg       t  | gc       c  |        a ta        gt       a  t g  g       gc       t  g a  a       cg        gc c  c       at        cg tg        gt        cg cg       a  a      c  t gc       c  c      a  a at        gc       t  t a  a       gc        ta gt        cg        gc at       |  t       cg at        ta        ta gc        ta        at gc        gt        cg                         cggttcttttcatcaatacgacgtgaccagtatccctgacattgccgccatggaatacgaacaacttgaatccaccggtatgtagcccaacgctgatagtctgacaagcagtctgatttgtttgcaatccatggtttcaaggagccttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0165 Argininosuccinate lyase ... can be seen here     ..................................................................................................................