Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:132 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-23.40 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -5.00 kcal/mol
Anti-antiterminator:   Size=14 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGCCCATCGCTATGGAGGAAGGCCTGACCTTCGCTGTGCGTGAAGGTGGCCACACCG
TCGGCTCCGGTCGTGTGACCAAGATCCTCGCCTGAttttcatcagacaagaatcttcgcttgaactagcgttat
aggaaatccccttcgaggaaactcggaggggattttctataaccgcagcaggatatggatatgtaccacgacttccggcctggatgcgctagtgttgctt
ttcaatagataaacggactgctgcactgcgaggatatgacactgatggcaggccgggaaagaaggtcgATG

    BL1096


Gene: BL1096     GI: 23465665     BI number: BL1096     GOG: -------     Description: hypothetical protei


           at
          a  c
          a  c
           gc
           gc
           at
          t  |
          a  |
          t  |
          t  |
          g  |
          c  |
          g  |
          a  |       aa
          t  |      g  a
          c  |       gc
          a  |       at
           at        gc
           gc        cg
 aa        tg        tg
g  c       ta        ta
t  t       cg        cg
 ta       g  |       cg
 cg        cg        cg
 gc        ta        cg
 cg        ta        ta
                        ttttctataaccgcagcaggatatggatatgtaccacgacttccggcctggatgcgctagtgttgcttttcaatagataaacggactgctgcactgcgaggatatgacactgatggcaggccgggaaagaaggtcgATG


    ..................................................................................................................