                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:112 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-19.70 kcal/mol
Antiterminator: Size=74 nt.     Delta G=-16.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atgagcacacatccgcaaagttgtgtatagtattcacctgttgcgcgaattcagcttgctgaatacggcactatgGTGGCCATAGCTCAG
TTGGTAGAGCATCTGATTGTGGTTCAGAAGGTCGCGCGTTCGAGCCGCGTTGGCCACC
CCAgtaaaacccttccgttcgcggaagggttttgttttttctccctgaattccccgctcctgggttataggccaaataggcatgccgggaaccaccgc
gttgtacactcagggcatatccaattcaccgaacataaggacaaaaggtccgtcATG

    His Gene: BL1103     GI: 23465672     BI number: BL1103     GOG: COG2008     Description: possible low specificity-threonine aldolas   G C  A T  G T  C GC CG GC CG |  T GT CG TG GC GC A  | A  | G  | A  | C  | T  | TA GC GC T  C GC TA Tg At        tc G  a      t  g T  a       gc C  a       cg T  a       cg A  c       ta C  c       ta Gc        cg At        cg Gt        cg A  |       at T  |       at Gc        at Gc        at Tg        tg             ttttttctccctgaattccccgctcctgggttataggccaaataggcatgccgggaaccaccgcgttgtacactcagggcatatccaattcaccgaacataaggacaaaaggtccgtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG2008 Threonine aldolase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_longum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:119 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-14.30 kcal/mol Antiterminator: Size=74 nt.     Delta G=-16.90 kcal/mol Anti-antiterminator:   Size=26 nt.     Delta G=-10.70 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case atgagcacacatccgcaaagttgtgtatagtattcacctgttgcgcgaattcagcttgctgaatacggcactatgGTGGCCATAGCTCAG TTGGTAGAGCATCTGATTGTGGTTCAGAAGGTCGCGCGTTCGAGCCGCGTTGGCCACC CCAgtaaaacccttccgttcgcggaagggttttgttttttctccctgaattccccgctcctgggttataggccaaataggcatgccgggaaccaccgc gttgtacactcagggcatatccaattcaccgaacataaggacaaaaggtccgtcATG     His Gene: BL1103     GI: 23465672     BI number: BL1103     GOG: COG2008     Description: possible low specificity-threonine aldolas             c           c  t           c  t           a  c            ac            ag            at            tt           |  c            gg            A            C            C            C           C  |           A  |           C  |           C  |           G  |           G  |            T            T            G           C            G            C            C            G   G       A C  A      G T  G      C T  C      T GC       T         tc CG       G        t  g GC        C        gc CG        G        cg |  T       C        cg GT       G  |       ta CG       C  |       ta TG        T        cg GC        G        cg GC        G        cg                         ttttgttttttctccctgaattccccgctcctgggttataggccaaataggcatgccgggaaccaccgcgttgtacactcagggcatatccaattcaccgaacataaggacaaaaggtccgtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG2008 Threonine aldolase ... can be seen here     ..................................................................................................................