                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:81 nt.     Distance to run of Ts=1 nt.   Size=22 nt.     Delta G= -8.70 kcal/mol
Antiterminator: Size=39 nt.     Delta G=-13.40 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-20.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCAAGCTGATCCTTGAGGAAGGCATCAGCTCCGACCCGTTCGAGCGCAAGGTCGTCTG
Attcgtctgattcgattcaattctgattcggctcccgctggcgggagccgggggcgaagccgactgagggtggctgtcctcaactcggctggactgtccg
gctcctgcggacgggagtcattgtttattagtgtccgtcatgcaacgcggacgggatttcttgtgcctacggcatggtaggttggccgtcagttagtcgc
cggtcaccgtgccggcaacccggcatgtcggagaggtgagaaGTG

    BL1151 Gene: BL1151     GI: 23465717     BI number: BL1151     GOG: COG0454     Description: hypothetical protei   t c  g a  t gc gc tg cg gc gt         t c  c      t  a t  c      t  t c  |       gt a  |       ta at        tg cg        at t  c       cg cg       t  | cg       g  | ta       a  |        a gc        gt       a  c |  g       gc        cg |  g       gc        gc |  g       cg        tg ta        at       a  | cg        gc        cg gt       |  a       ta gc        gt        gc ta        cg        cg gt        gc        cg gt        ta        tg                         atttcttgtgcctacggcatggtaggttggccgtcagttagtcgccggtcaccgtgccggcaacccggcatgtcggagaggtgagaaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [KR] COG0454 Histone acetyltransferase HPA2 and related acetyltransferases ... can be seen here     ..................................................................................................................