                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:51 nt.     Distance to run of Ts=0 nt.   Size=15 nt.     Delta G= -8.50 kcal/mol
Antiterminator: Size=22 nt.     Delta G= -8.20 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-17.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCACGATCATCCCCCTGGTGATCGCGTTCCTGTGCCTGCAGAAGTACTGGCAGTCCGG
ACTCGCCGCAGGCGCCGTCAAGGAGTGAtggagtcggctccgccgacgcggtgtcttcaccgcctcgcggcggggtctc
tccctccgtcccggctccgccgagacaaccttcctcatcagagggaggtaatagtgccaagcccctctctgacgagctgagccgttaggcaaacagccct
gtgggctgtttattcccgcggacgcagattatcgataaaattcaataaaggagctgaatcatcATG

    bga Gene: bga     GI: 23465734     BI number: BL1168     GOG: COG1874     Description: beta-galactosidase   t g  g a  c t  c a  a a  a tg gc gc a  c gc gt gc at gc at        tt cg       g  a ta        cg a  c       cg cg        gc         g ta       |  a      t  t cg       |  a       cg |  c      a  a       cg c  t       gc        cg tg        ta        gc ta        cg        at cg        gc        cg                         tttattcccgcggacgcagattatcgataaaattcaataaaggagctgaatcatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1874 Beta-galactosidase ... can be seen here     ..................................................................................................................