                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:85 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-21.80 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -6.10 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -6.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCCCTGAGGCCGTGGCCGTCAAGAAGGGCGATTCCAAGACCGCCGAGGCCGTACAGAA
GGCCATCCAGAAGCTGATGGATGATGGCACGTACAAGAAGATCCTCGACACGTGGGGC
GTCTCTTCCGGCGCCGTCGACAAGGCCGAGATCAACCCGTCCGTCGAGTAGtttcggttact
atgaagactcccgttgccctgcggcgggagtctttttgtatatgtatgcactgtagtgtataaatatgcttaaccgttgatcgttgccgttgaagcggcg
taagagagaagaagaaacgattATG

    BL1178 Gene: BL1178     GI: 23465744     BI number: BL1178     GOG: COG0834     Description: probable solute binding protein of ABC transporter syste             g           c  g           t  t   C       t  t T  A       ta A  A       Gc         c G  C       At       c  t A  C       Ta        cg GC        Gt        gc CG       |  g       tg C  T      A  a       tg GC       G  a       gc GC        Cg        cg A  |       Ta        cg A  |       Gc        cg CG       C  t       ta AT       C  c       cg GC       T  c       at CG        Gc        gc TA        Cg        at                         ttttgtatatgtatgcactgtagtgtataaatatgcttaaccgttgatcgttgccgttgaagcggcgtaagagagaagaagaaacgattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [ET] COG0834 ABC-type amino acid transport/signal transduction systems, periplasmic component/domain ... can be seen here     ..................................................................................................................