                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:114 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -7.50 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-12.50 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-16.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCTCGGTGCTCTCGTGCCTGATGCTTTCGGCTATCGTCAACGTGTTCGTCACCGGCT
GGCTGGCGAAATCCGTTACATGGATTCCTTATGTGAATCAGCTCACGGTACTGGTGAT
ATCGCCGTTCCTGGTTGTGGGCGCGATACTGCTGTCCATCATCGCTTCAACCATCTCG
TTGCGGCGTTATTTGAGGGCGTAAcgcgaccggcttacccgcgagaaatgtgatgacatcatgtgcaagcctctcaggttcg
catgttatggtattggcttaagtgagcgaaaggactattcacatATG

    BL1181 Gene: BL1181     GI: 23465747     BI number: BL1181     GOG: COG3942     Description: hypothetical protein with weak C-terminal similarity to Tra TA A  T GC        TA TG       A  C GC        GT GC        CG T  |       GC CG       |  T AT        CG T  T       GT GC        GC GC        GC |  T       TA |  G      |  T |  G      |  C |  T      |  A |  T      |  T       TC CG       |  C      A  T AT       |  G      C  C CG       |  C       CG TG       |  T       AT CG       |  T       AT GC        GC        CG |  G       TA       T  C A  C       TA        TG CG        GC        CG TA        GC        GC AT        TA        CG                         TTATTTGAGGGCGTAAcgcgaccggcttacccgcgagaaatgtgatgacatcatgtgcaagcctctcaggttcgcatgttatggtattggcttaagtgagcgaaaggactattcacatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3942 Surface antigen ... can be seen here     ..................................................................................................................