                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:18 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-10.30 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-11.60 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G= -7.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ccagaagctttcagaaacgtaagtcataccgcctattgtctcacgcttgggccggtgcggctaggcgattcctgcctaggcgaattggggaagggggcta
ctgcgtgtcgaggcgcacgcaggcgtcggctcggcagaagatacatgaaccgggacgcaccaggtatcaggcgtgactctccgctgagcaacgcgcgcgg
gagagtcgtcggtcgtgagctatcgcgctagtagccgctgtgagaatatcggttcgcgcaatgtgcgattttgcgcggttttgtggaaatgacacctgaa
TTG

    BL1212 --- galT1 --- galK Gene: BL1212     GI: 23465780     BI number: BL1212     GOG: COG1349     Description: probable DeoR-type transcriptional regulator Gene: galT1     GI: 23465779     BI number: BL1211     GOG: COG1085     Description: galactose-1-phosphate uridylyltransferase Gene: galK     GI: 23465778     BI number: BL1210     GOG: COG0153     Description: galactokinas            ag           g  a            ta            gt            ta           c  t ct        gc g  a       cg at        cg gc        gt tg        at         c gc       t  c      g  g cg       g  |      t  a |  c      a  |      g  t |  t      t  |      t  t |  a       cg        at |  g       gc        at |  t       cg        cg |  a       gc        gc tg       c  a       cg gc        ta        gc gc        at        cg cg        tg        tg                         ttttgtggaaatgacacctgaaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [KG] COG1349 Transcriptional regulators of sugar metabolism ... can be seen here [C] COG1085 Galactose-1-phosphate uridylyltransferase ... can be seen here [G] COG0153 Galactokinase ... can be seen here     ..................................................................................................................