                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:56 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-20.00 kcal/mol
Antiterminator: Size=22 nt.     Delta G= -5.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGCGAGGTCATCTTCCAGCAGGCCGGCGCGCTGCAGGCCTCCGATCTGGACGACCTC
ATCGCCCAGGCCAAGGCGCTGGATCTGGCCGCCGCCAAAGCACAGCAGGCAGCGCAGG
AGCAGCAGTAAgccttatcacactgcggcaacggaagcgtggaaaagcccatatatagcgtttccttgcactgctaactactacatatgcca
tccgtggcgggtcgaacacccaccacggattttttattcatccactcaacgtcctatgatggagagcagtgtgtacccaaccaaggagcgcaATG

    BL1227 Gene: BL1227     GI: 23465794     BI number: BL1227     GOG: COG3583     Description: narrowly conserved hypothetical protei             a           g  a           c  c            ta cc        gc t  g       gc at        gc cg       c  a cg        gc gc        gc tg        ta a  g       gc t  |       cg a  |       cg cg        ta at        at             tttttattcatccactcaacgtcctatgatggagagcagtgtgtacccaaccaaggagcgcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3583 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................