                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:99 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -8.60 kcal/mol
Antiterminator: Size=30 nt.     Delta G=-10.90 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G= -6.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CACCGTGTTCGGCGGTCGCCTGGGCACGTACAAGTACTACGACATGCACAACGTGATC
GACACCGCCCTGACCGCTTACGAGGAGCAAGTCGCACCGCTGCTGAAGAAGTAGaccgtc
gtttcgccagaggattaacgattgagcctgaaaccgactgaatattgctgaggcaatagccggtttcaggcttttgtgttttttggaagccaaatttcct
ggggtgcttaaggctcgccacgaggagtacagttgtctgtaacgcacaatgtggcgcgtaagacgaggggcgcatctcgcaaGTG

    BL1246 Gene: BL1246     GI: 23465808     BI number: BL1246     GOG: NOG41634     Description: hypothetical membrane protein with unknown functio   g c  a at at tg ta a  g gc gc at        ga g  |      t  g a  |       cg         t c  |       gc       t  t c  |       ta       g  c g  |       ta       g  a cg        at        cg ta        ta        cg ta       a  g       gc ta       a  c       at |  c       gc       t  t gc        tg        at cg        cg        at ta        at        cg gc        gt        gt                         gttttttggaagccaaatttcctggggtgcttaaggctcgccacgaggagtacagttgtctgtaacgcacaatgtggcgcgtaagacgaggggcgcatctcgcaaGTG     ..................................................................................................................