Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:10 nt.     Distance to run of Ts=3 nt.   Size=22 nt.     Delta G= -8.00 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -7.80 kcal/mol
Anti-antiterminator:   Size=21 nt.     Delta G= -8.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cagtcataataagggcgattatgccatctcacatagtgaaatagcaaattggggaagtgtctcacagggtggccatgaagttgaaagggcgttcgtggat
gccgaagagacatgtctggagcggaaccgagtcatgactaggtcatgttcgagtcgtatccgagtcatattgaggccatcatttgaccgtatctcaatat
ccggcatgctcatggccgggcccatcgcaagcacataggctaataccacgaacaaggcgcgaacacaatacctcgcgcggaattttttggaggaatcact
ATG

    leuC


Gene: leuC     GI: 23465824     BI number: BL1262     GOG: COG0065     Description: 3-isopropylmalate dehydratase large subuni


           at
          c  a
          a  g
           cg
           gc
           at
          |  a
          |  a
          |  t
          |  a
          |  c
          a  c
          c  a
           gc
           cg
  t        ta        aa
c  c      |  a      c  t
g  a      |  c      a  a
t  t      a  a      c  c
a  g      c  a      a  c
 cg        cg        at
 gc        cg        gc
 gc        gc        cg
 cg       g  g       gc
 cg        gc        cg
 tg        cg        gc
                        ggaattttttggaggaatcactATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0065 3-isopropylmalate dehydratase large subunit ... can be seen here

    ..................................................................................................................