                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:14 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-18.90 kcal/mol
Antiterminator: Size=25 nt.     Delta G= -5.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCGTCCAGCTCTCGCAACGGTCGCGATTCTAACCCGCAATACCTCGGCGTGAAGAAG
TTCGGCGGCGAAGCCGTCGTGGCCGGCAACATCATCGTTCGCCAGCGTGGCACCAACT
TCCACCCGGGCCACAACGTCGGCATGGGCAAGGATCACACGCTGTTCGCCCTCACCGA
TGGCTCCGTGAAGTTCGGTGTGCGTCGCGACCGCAAGGTTGTCGACGTCATCGCCTGA
gcgatatagcgtcaagcttttttcaagccgcgcccgtaaggacgcggcttttttgtaaggtaatcaatATG

    obg --- proB Gene: obg     GI: 23465846     BI number: BL1284     GOG: COG0536     Description: GTP-binding protein Gene: proB     GI: 23465847     BI number: BL1285     GOG: COG0263     Description: glutamate 5-kinas   t t  t       ta t  c      g  a ta        cg ta        cg cg       c  a gc        gc a  c       cg a  |       gc c  |       cg tg        cg gc        gc cg        at gc        at             ttttgtaaggtaatcaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0536 Predicted GTPase ... can be seen here [E] COG0263 Glutamate 5-kinase ... can be seen here     ..................................................................................................................