                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:202 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-21.70 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:   Size=19 nt.     Delta G= -3.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCACGCCTTACGAGCTGAAGAAGTATCTGCCGAAGCTGTAAtcgcaagcgttgcacatgtgccaaacccc
gtcgatgattggtcatcggcggggttttctatggcgtgtcgtggtggtgggtagcgggcagaggcgggaataacgttgtcgctgagttgatacgaaaaaa
cgattgacgtaaccgacgaatcagcttgtagtacgagcgagagcactcaagagagcactcaagagagcacccaagagagcacccatgacgaacgcacctg
cgaacaccgcgcgtaccggccggcacttggGTG

    BL1303 Gene: BL1303     GI: 23465864     BI number: BL1303     GOG: COG2814     Description: hypothetical transmembrane protein possibly involved in transpor            at           c  g            at            cg            gc           |  c           |  a            ta            ta            gc           c  c           g  c       tg           a  c      t  g           a  g       at           c  t       gc aa        gc        ta c  g       cg        at gc        ta        gc cg        At        cg t  |      |  g       tg At       A  a       gc At       T  t       cg Tg        Gt        cg Gc        Tg        cg Ta        Cg        cg                         ttttctatggcgtgtcgtggtggtgggtagcgggcagaggcgggaataacgttgtcgctgagttgatacgaaaaaacgattgacgtaaccgacgaatcagcttgtagtacgagcgagagcactcaagagagcactcaagagagcacccaagagagcacccatgacgaacgcacctgcgaacaccgcgcgtaccggccggcacttggGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG2814 Arabinose efflux permease ... can be seen here     ..................................................................................................................