                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:117 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-21.60 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -7.30 kcal/mol
Anti-antiterminator:   Size=20 nt.     Delta G= -5.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACACCGCCGCCTACGTCTGCACCCAGGCCGGTGCCTGGCCGCAGTACCCGGCCGAGA
TGCCCGACTATCTGGCTGAAATCGGCAAGTAAtccacccatccccttatccgccattcgtgcgacttcacgaatcg
actgatcgcaaccggtgagattctccgaacaggaaatctcaccggtttttcatatggtgcgctcacactcatgctcttcacatcctttcgcgtgtcatga
actaaagcggtttagaataatgctgttcccttgatatgtatacccctcaaacaaagaagttgaattATG

    BL1338 --- BL1337 Gene: BL1338     GI: 23465899     BI number: BL1338     GOG: COG3538     Description: narrowly conserved hypothetical protein Gene: BL1337     GI: 23465898     BI number: BL1337     GOG: COG2942     Description: narrowly conserved hypothetical protein with possible isomerase functio            gc           c  a           t  a           a  c        a            gc       a  c            tg       g  a            cg        cg            at        cg           |  g       ta           g  a      c  |            cg        ta ac        ta        ta g  t       at        at c  t       at        gc gc        gc        at ta       |  t       gc gc       c  c       ta cg       a  c       gc ta        cg        gc ta        ta        cg at        ta        cg                         tttttcatatggtgcgctcacactcatgctcttcacatcctttcgcgtgtcatgaactaaagcggtttagaataatgctgttcccttgatatgtatacccctcaaacaaagaagttgaattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3538 Uncharacterized conserved protein ... can be seen here [G] COG2942 N-acyl-D-glucosamine 2-epimerase ... can be seen here     ..................................................................................................................