                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:38 nt.     Distance to run of Ts=1 nt.   Size=21 nt.     Delta G=-16.60 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -9.80 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-29.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAAGCTCGAGACCGAAGACCTCTCCACCATCCCGCTGCTGCAGGGTGCCCAGGTCGCC
GTCACCGGCACCTCCGTGAAGGGTGTCACCCTCGACGCTTCCTTCCGCTTCCGCTATG
CCTCCGTCACCAAGGGCTGAtccagcatgagctcccctctttgaggggggagctgtctgccgacggcagactgaggggagcccaa
ctcgtatgactcccctcagtcggcttcgccgccagctcccctcggagaggggagcctttattgctttatataccgattaccaacaccaaggagcatcgcG
TG

    BL1346 Gene: BL1346     GI: 23465907     BI number: BL1346     GOG: COG0601     Description: probable permease of ABC transporter for peptide   c t  g c  t a  a at cg c  a c  | gc        cg at       t  c gc       t  c gc        cg gc        gc gc        gc at       c  a gc        tg ta        gc cg        at         g at       |  c      g  a gc       |  c       cg a  g      c  c       ta cg       t  c       cg gc       c  t       cg gt       c  c       cg c  |       cg        cg at        cg        ta gc        ta        cg cg        cg        gc                         ctttattgctttatataccgattaccaacaccaaggagcatcgcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EP] COG0601 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here     ..................................................................................................................