                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:82 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-20.40 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -6.80 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -5.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGCTTGGCAGTGCTACACCGCCACTGGCGCACCGTTCGCCGAGCATCCGTATGGCAT
CGCCGTCGAGCCGATGACCGCCCCGGCCAATGCCTTCCGCACTGGTGACCACTTGGTG
ACGCTCGCCCCCAACGGCGACTACACCACTGTGGTCCGCTACGAAGTAGTCCAGAAGT
AGttctgttacgctggctcccctccagaggggagccaattttttatccttatgtgccgccgcgtcttgggacttatgcgatacgattgtgagcgataac
aatttgttccacaaaggagtgtgcactATG

    BL1359 Gene: BL1359     GI: 23465920     BI number: BL1359     GOG: COG2017     Description: hypothetical protein with possible aldose-1-epimerase domai            TA           G  G            At   A        At G  A       Gc CG        At AT        Cg TA       C  | CG       T  | GT        Gt        ca C  |       At       c  g C  |       Ta        ta T  |       Gc        cg GC       A  g       cg GC       A  c       cg TA       G  |       cg |  G      C  |       ta G  A       At        cg TA        Tg        gc CG        Cg        gc AT        Gc        ta                         attttttatccttatgtgccgccgcgtcttgggacttatgcgatacgattgtgagcgataacaatttgttccacaaaggagtgtgcactATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG2017 Galactose mutarotase and related enzymes ... can be seen here     ..................................................................................................................