                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:92 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G=-14.20 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -8.72 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G=-16.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACCCGACCCAGACCGACGTCAACACCATTGATGGCGTGACCCTGGCTCGCACCGTGT
CCTTCTACGACAACGAGTACGGCTTCACCTCCAACATGATCCGTACCCTGCTGTACTT
CGCTGAGATCTCCGAGTGAaccattgcggtctaggccgctacggttcgtttgagaactaagctgtgagacccccgccttgtgcggg
ggtttcttcgtagtagaacggtaatcatggcaaagaaaagcaagcatgataagggcgcgggttccactccggcgacagtccaactggagaaggcgggcGT
G

    BL1362 Gene: BL1362     GI: 23465923     BI number: BL1362     GOG: COG2606     Description: conserved hypothetical protein very similar to YbaK of E. col            tt           t  g           g  a            cg            ta            ta            gc            gt           c  a           a  | ta        ta c  g       cg tg        gc gc       |  t gc       |  g cg       |  t gc       |  g t  t      |  a t  a      |  g a  c      |  a        t cg       |  c      t  g cg       |  c      c  t at       |  c       cg At       |  c       gc Gc       c  c       cg Tg        cg        cg Gt        gc        cg At        gc        cg Gt        at        cg                         tttcttcgtagtagaacggtaatcatggcaaagaaaagcaagcatgataagggcgcgggttccactccggcgacagtccaactggagaaggcgggcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2606 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................