                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:121 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -8.00 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-26.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCCTGCTGTTCTCCGCACGCCGAGGAGAAGCCATCACCGGCTTCGTCCATCCACGTCA
GGCCATCATCCAACTGCGCCCCGCCATGTAActgcgtaccgccatgtaggcccgtgcgcaggttcccctcgccgcct
gtcacgaagaaggccgcgcgagggggatgaagttcccgcttgttttcgtgagaagaccgtgtggctccgctgttcgaaaggctcaaaggagtaaggtagt
ctgtaccgtttttcgggaaacgcatcgaagttgatgcggcgaatggttaagggggatgatgacgtATG

    BL1383 --- BL1384 Gene: BL1383     GI: 23465945     BI number: BL1383     GOG: -------     Description: hypothetical protein Gene: BL1384     GI: 23465946     BI number: BL1384     GOG: COG0582     Description: probable integrase/recombinase protein similar to RV2894   g c  a a  a cg ta g  | ta cg cg |  c gc cg |  c cg gc        aa cg       g  g ta       t  t cg        at cg        gc cg        gc cg        gc tg       g  g ta        gc gt        at             tgttttcgtgagaagaccgtgtggctccgctgttcgaaaggctcaaaggagtaaggtagtctgtaccgtttttcgggaaacgcatcgaagttgatgcggcgaatggttaagggggatgatgacgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0582 Integrase ... can be seen here     ..................................................................................................................