                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:58 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-21.20 kcal/mol
Antiterminator: Size=29 nt.     Delta G= -4.30 kcal/mol
Anti-antiterminator:   Size=25 nt.     Delta G= -5.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGCCTGAGCTACCTGTTCATCACCCACGATCTGGCCGTGGTTCGTCAGATCGCCGAC
GAGGTTGTGGTGATGCAGCACGGCAAGCTCGTGGAGCACGCCACCACCGACGAGGTCT
TCGACCACCCGCAGAAGCAGTACACCCGAGACCTGCTCGACGCCATCCCCGGCGGCAA
GCTCCAACTCGGTCTGGACTGAtaggacattctaaattagctccctcttatgagggagctaattttttatacctcaatgtaatc
gtgagtgcggtactggtagagaggccaaaatagtatggctgcATG

    BL1391 Gene: BL1391     GI: 23465951     BI number: BL1391     GOG: COG0708     Description: possible exodeoxyribonucleas             a           c  t       ta           a  t      t  t TG        gc        cg C  G       gt        ta TA       |  a       cg GC       a  a       cg GT        ta        cg CG        At        ta TA        Gt        cg C  t       Ta        gc A  a       Cg        at A  |      |  c       ta Cg        At        ta Cg        Gc        at Ta        Gc        at                         ttttatacctcaatgtaatcgtgagtgcggtactggtagagaggccaaaatagtatggctgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0708 Exonuclease III ... can be seen here     ..................................................................................................................