                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:20 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-15.50 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -5.00 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-14.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACTGAGCTACGCAGGAatattcaattttcatcccggccggagttacccgttcaggtgagctcctgcgactgggcttgaaccagtgacc
gtccgatatacggttctggctcgcagccgtagggctttttgcaacaggagtagacaatacaccagccttgctgttccttcaaatcggcgtgtcatcgcgc
atgttcgccttgcagctggttttccgaagagcatcggccagaaacgcgcaatagtattccttgggaagtgatgaagaagtcacttcccttttctatgcgc
ttaaggagccccATG

    BL1458 Gene: BL1458     GI: 23466014     BI number: BL1458     GOG: COG0582     Description: probable integrase/recombins tt t  t gc gc tg |  a       ca c  a      g  a g  g      c  t a  a      g  a cg        cg gc        at ta       |  a |  t       at t  c       at cg        gc cg       |  c gc       |  t       ag |  c      |  t      a  a |  a      a  g      g  a cg        cg        tg ta        cg        at ta       |  a       gc g  a      |  a       ta t  c      g  g       gc a  |       gt        at cg        cg        at gc        ta        gc cg        at        gc gc        cg        gc                         ttttctatgcgcttaaggagccccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0582 Integrase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_longum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:173 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G= -9.60 kcal/mol Antiterminator: Size=34 nt.     Delta G=-12.00 kcal/mol Anti-antiterminator:   Size=56 nt.     Delta G=-18.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ACTGAGCTACGCAGGAatattcaattttcatcccggccggagttacccgttcaggtgagctcctgcgactgggcttgaaccagtgacc gtccgatatacggttctggctcgcagccgtagggctttttgcaacaggagtagacaatacaccagccttgctgttccttcaaatcggcgtgtcatcgcgc atgttcgccttgcagctggttttccgaagagcatcggccagaaacgcgcaatagtattccttgggaagtgatgaagaagtcacttcccttttctatgcgc ttaaggagccccATG     BL1458 Gene: BL1458     GI: 23466014     BI number: BL1458     GOG: COG0582     Description: probable integrase/recombins cc t  t cg gc |  g |  a |  c |  t a  g g  g tg                   t gc                 c  c gt                 g  g at         a        gc cg       g  t       ta ta       c  a       cg ta       c  t      t  | gc        ta       t  | c  c       gc        gc c  a       cg        gc cg        cg        cg at        at        at tg        gt        ta ta       t  |      a  | gc        gc       t  | |  c       at       a  | |  g       cg       g  | at        cg        cg gc       a  c       cg gc        at        tg cg        gc        gc                         tttttgcaacaggagtagacaatacaccagccttgctgttccttcaaatcggcgtgtcatcgcgcatgttcgccttgcagctggttttccgaagagcatcggccagaaacgcgcaatagtattccttgggaagtgatgaagaagtcacttcccttttctatgcgcttaaggagccccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0582 Integrase ... can be seen here     ..................................................................................................................