                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:94 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-25.90 kcal/mol

                                                                        Nomenclature/Definitions

CAACACGTTCGACAAGCTCGCCGCGATGCCCGAACCGACACCGGCGAAACAAGAAAAA
GACGAGCTTTCCGCCGGCGCATGCGATCCGGCCGACCCGTTGAACCTCGAACAGTCAT
CGTCATACGGCATGACCCGGTGAacgtaagaaacgacacggataagggccatggaatcatcggacgacaacgatgattccacg
gcctttttccaggactttctcgaaggcaagaaaatcgtcggactgtccatgtgacgcgcctgcgcttgtagacttatggaagcatcgattaaggagccga
tATG

    BL1462 --- BL1461 --- BL1460 --- BL1459 Gene: BL1462     GI: 23466018     BI number: BL1462     GOG: COG3177     Description: hypothetical protein with similarity to ZK593.8 protein of C. elegans Gene: BL1461     GI: 23466017     BI number: BL1461     GOG: NOG48081     Description: hypothetical protein Gene: BL1460     GI: 23466016     BI number: BL1460     GOG: NOG45233     Description: hypothetical protein Gene: BL1459     GI: 23466015     BI number: BL1459     GOG: -------     Description: hypothetical protei           ga          c  c          a  a          g  a           gc           cg           ta           at           cg           ta           at           at           gc           gc           ta          a  c           cg           cg           gc           gc             tttttccaggactttctcgaaggcaagaaaatcgtcggactgtccatgtgacgcgcctgcgcttgtagacttatggaagcatcgattaaggagccgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3177 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................