                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:77 nt.     Distance to run of Ts=3 nt.   Size=37 nt.     Delta G=-24.90 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-15.10 kcal/mol
Anti-antiterminator:   Size=37 nt.     Delta G=-11.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGGCTCTCCGATTGGCTCTCACAGAACGCCGTCGGCCATGTGCCCGGCGGGCTGACT
TTGGCCCAATCGTCTGGGGTCGTGGAAAAGACGAATGATGCCGTGAACGGGATGGGCA
TCGTGCCCGGTGTTCCCCTCGACGGCCTCGATGGAGGTTCCGGCTTACTGGGGTGAcg
gtcgtggcgtccgggggaagtttgctcccgaacgccacgggattatttacgcgatgatttcgcggggtgtcgggccgcgcccttctcatgtgctatcctg
ggtttctcgggaatcggaggaaccgtATG

    BL1473 Gene: BL1473     GI: 23466029     BI number: BL1473     GOG: COG0270     Description: modification methylase very similar to EcoRII (cytosine-specificmethyltransferas AT        GG G  G      T  G CG        CG         t TA        AT       g  t CG        TG       a  t CG       |  A      a  g |  T      |  c       gc |  T       Tg        gt GC        Cg        gc GC        Gt        gc CG        Gc        gc |  G       Cg        cg |  C      C  t      c  a |  T      T  g       ta A  T       Tg        gc G  A       Gc        cg C  C      G  g       gc T  T       At        gc CG        Gc        ta CG        Gc        gc CG        Tg        cg                         ggattatttacgcgatgatttcgcggggtgtcgggccgcgcccttctcatgtgctatcctgggtttctcgggaatcggaggaaccgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0270 Site-specific DNA methylase ... can be seen here     ..................................................................................................................