                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:68 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-18.60 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -4.92 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCTTCATGAACGCGCTGGACGAGAACCTGGCCAAGGCTCTGGCCGAGTAAatcatcgaa
cacatcgtgcggacctacatgggtcatgtcatgtcgcaaactgtcatgattgtcgtgcttcatctggaatgttcctcagcacgataatcatgacagttgt
tcgatgcacgcacgtaatacctctaattgttcccggatatgtggcgatttgtccactggtccgggactttttcgtatacggcctactagaatcgtgattc
agcttgttttcacgcccgcttgaggaggtttcgccgcttATG

    BL1498 Gene: BL1498     GI: 23466054     BI number: BL1498     GOG: -------     Description: hypothetical protei   t t  g a  t a  t       tt t  c      a  t c  c      g  g t  c      c  t cg        gc cg        gc a  a       ta t  |       gc a  |      t  t at       a  g ta        tg gt        at cg        gc at        gc |  g       cg cg        cg gc        cg cg        ta             ctttttcgtatacggcctactagaatcgtgattcagcttgttttcacgcccgcttgaggaggtttcgccgcttATG     ..................................................................................................................