                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:138 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-14.30 kcal/mol
Antiterminator: Size=16 nt.     Delta G= -4.70 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-19.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgcgggaatctggtggggatttcgctggcacaccggatttcaagcaaaccccgcctcgggaaccgctccggacttcggcgttggcccggttcgtatgtca
atcgattgccgtctgaaccgggacagaatccgctgtcccggttcgcgatttttgtccttttttacaaacagggacaagccaatctccgcaggtcatatgc
tccgtaatacaaaatcggcggaatagagccgatcccggaatcaacatgttgtcccggttttcacataaaacgattgacattcataccgggacaatgaaaa
TTG

    BL1524 Gene: BL1524     GI: 23466078     BI number: BL1524     GOG: -------     Description: hypothetical protei cg t  a at at                   c cg                 c  g t  c                c  g gc                 t  t tg                 g  t at                 t  c t  c                 cg gt                  gc cg                  cg ta                 c  a ta                 t  t gc                  at gc        tc        at cg       a  c       gt cg       a  g       at cg        gc        cg g  a       at        at gc        cg        gc ta        at        gc tg        gc        gt                         tttttacaaacagggacaagccaatctccgcaggtcatatgctccgtaatacaaaatcggcggaatagagccgatcccggaatcaacatgttgtcccggttttcacataaaacgattgacattcataccgggacaatgaaaaTTG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_longum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:147 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-25.50 kcal/mol                                                                         Nomenclature/Definitions tgcgggaatctggtggggatttcgctggcacaccggatttcaagcaaaccccgcctcgggaaccgctccggacttcggcgttggcccggttcgtatgtca atcgattgccgtctgaaccgggacagaatccgctgtcccggttcgcgatttttgtccttttttacaaacagggacaagccaatctccgcaggtcatatgc tccgtaatacaaaatcggcggaatagagccgatcccggaatcaacatgttgtcccggttttcacataaaacgattgacattcataccgggacaatgaaaa TTG     BL1524 Gene: BL1524     GI: 23466078     BI number: BL1524     GOG: -------     Description: hypothetical protei           tc          a  c          a  g           gc           at           cg           at           gc           gc           gc           cg           cg           at           at           gc           tg          |  c           cg           ta           gt             ttttgtccttttttacaaacagggacaagccaatctccgcaggtcatatgctccgtaatacaaaatcggcggaatagagccgatcccggaatcaacatgttgtcccggttttcacataaaacgattgacattcataccgggacaatgaaaaTTG     ..................................................................................................................