                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:81 nt.     Distance to run of Ts=1 nt.   Size=35 nt.     Delta G=-11.80 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -3.72 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCCCGAGGCTCTGGACAAGGTGCTCGACGAGGCCACCGTCGTGGTAGACAAGGCCCTG
AGCGAGTGAaatcgctgcgttagtcgcgttcacagcaaccaataaggctctgcattggattcatgcaatccactgcagagctttttttagcgca
tatgcagttcgcgaccactgaaacacgcaggtcaacggttctcctcatgcaccgtgaccgcattttctcaacatcactgcagggcaggacggccatatgg
ccgcgaaacgttcgcctgcctacattatgaccgagtttcccatcatcaTTG

    BL1629 Gene: BL1629     GI: 23466178     BI number: BL1629     GOG: -------     Description: hypothetical protei             t           c  c           c  a   a       t  t a  c      c  g a  a      t  c g  c       ta t  g       gc c  c       gc a  a       cg cg       a  | cg        at at        cg gc        ta |  a       gc c  a       gc gc       a  | cg        cg tg        gc             attttctcaacatcactgcagggcaggacggccatatggccgcgaaacgttcgcctgcctacattatgaccgagtttcccatcatcaTTG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_longum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:155 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-22.40 kcal/mol Antiterminator: Size=33 nt.     Delta G= -4.80 kcal/mol Anti-antiterminator:   Size=48 nt.     Delta G=-11.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CCCCGAGGCTCTGGACAAGGTGCTCGACGAGGCCACCGTCGTGGTAGACAAGGCCCTG AGCGAGTGAaatcgctgcgttagtcgcgttcacagcaaccaataaggctctgcattggattcatgcaatccactgcagagctttttttagcgca tatgcagttcgcgaccactgaaacacgcaggtcaacggttctcctcatgcaccgtgaccgcattttctcaacatcactgcagggcaggacggccatatgg ccgcgaaacgttcgcctgcctacattatgaccgagtttcccatcatcaTTG     BL1629 Gene: BL1629     GI: 23466178     BI number: BL1629     GOG: -------     Description: hypothetical protei aa A  t Gc Tg Gc At |  g                  t Gc                 a  g Cg         t       c  c Gt       a  a       ta At       a  a       ta G  a       cg        at T  |       cg        gc C  |      |  c       gc C  |      |  t       ta Cg       a  c      t  c Gt        at        at Gc        cg        cg A  g       gc        gc A  c      a  a       ta Cg       c  t       cg At        at        ta G  t       cg        cg A  c       tg        gc Ta        ta        gt Gc        gt        at                         tttttagcgcatatgcagttcgcgaccactgaaacacgcaggtcaacggttctcctcatgcaccgtgaccgcattttctcaacatcactgcagggcaggacggccatatggccgcgaaacgttcgcctgcctacattatgaccgagtttcccatcatcaTTG     ..................................................................................................................