                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:24 nt.     Distance to run of Ts=1 nt.   Size=34 nt.     Delta G=-21.30 kcal/mol
Antiterminator: Size=37 nt.     Delta G=-11.00 kcal/mol
Anti-antiterminator:   Size=15 nt.     Delta G= -4.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACTTCACCTACATGCCTGGCTTCTCCGCAGTCGGCGCTGCAATGAAGCAGACCGCCGC
CAAGGCTGCCGATGGTTCTGCCAAGGTTTCGGATGTGTTCGACACCGCTCAGAAGACC
TCGGTGGATACGCTGAAGAACCTCGGTCTGTCCGTCAAGGAGTGAcctcactaggtcttgtcaacgg
gccggcttgaaatagccggccgtccaagacctctgatgcctcgcatcaccatagcgaaaggccggggcacatactccggccttccgtattgtttgggggt
attgctgcaggggcgctGTG

    BL1639 --- BL1640 Gene: BL1639     GI: 23466187     BI number: BL1639     GOG: COG1175     Description: permease of ABC transporter for sugars Gene: BL1640     GI: 23466188     BI number: BL1640     GOG: COG0395     Description: permease of ABC transporter for sugar             c           a  c           c  a           t  t           a  a       ca            cg       a  t            gc       c  a            cg        gc            ta        gt           |  a       gc           |  a       gc            cg        cg            cg        cg   t        gc        gc c  c      t  |       gc cg       a  |       at gc        gc        at ta        tg       a  c at        cg        gc gc        tg        cg ta        cg        gt                         attgtttgggggtattgctgcaggggcgctGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1175 ABC-type sugar transport systems, permease components ... can be seen here [G] COG0395 ABC-type sugar transport system, permease component ... can be seen here     ..................................................................................................................