                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:109 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-12.90 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -6.32 kcal/mol
Anti-antiterminator:   Size=29 nt.     Delta G=-12.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAATGGTACTCATGCGGCCATTTACATCGGTAACGGACAGGTGATGAATGCTATGAAC
CCGGTGCAGGGAACGGCAGTAAGCGACGTTTCCGTATTCGGTGGAGCTGGATATTCCA
TTCGCCGCGTGATGTGAcaagaattatgcggtaagcgaattcgtattaaggcacgtcctttggggtgtgcctttttcgtatacgcgga
tttctttttgagcggaggataccggccaaaccgagtgtcgcggggtattgttgagatacgcggtattcgtgccgcaataacttcaaggaggtcgtcATG

    BL1664 Gene: BL1664     GI: 23466211     BI number: BL1664     GOG: COG0589     Description: widely conserved protein in universal stress protein famil             t           g  a           g  a            cg            gc            tg           a  |            ta            ta            at   c        at A  a       gc G  a      |  g T  g      |  t G  a      |  a       tt Ta       |  t      t  g At       |  t       cg Gt       a  a       cg Ta       a  a      t  g Gt       c  g      g  t Cg       A  g       cg Gc        Gc        at Cg        Ta        cg Cg        Gc        gc Gt        Tg        gc                         tttttcgtatacgcggatttctttttgagcggaggataccggccaaaccgagtgtcgcggggtattgttgagatacgcggtattcgtgccgcaataacttcaaggaggtcgtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG0589 Universal stress protein UspA and related nucleotide-binding proteins ... can be seen here     ..................................................................................................................