                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:93 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-14.30 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-14.80 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-23.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTGCTAGTGGTCATCGGATGGAGTGGCTGGAATGCCGTCACCGGGTGGAACGCCAAG
GAGACTGAGGCCGCCACGGCGGGTGCCAAGGATGATGAGGGCAGCGCTGATCGGTAGC
GTATATACGGCTGTTGTTGCCGGGGACATATAGGTCCCGGCAAatctgcagcgatatgtgcattgcaa
gccagggattccctggcttttttatgtcgaaacggaactcgacacgggcgcgcaggccgttgggtttgtctagagcctgcatatagttacttatggtaat
gactattggtaactaaTTG

    BL1698 --- BL1699 --- fms Gene: BL1698     GI: 23466245     BI number: BL1698     GOG: -------     Description: possible MarR-type transcriptional regulator Gene: BL1699     GI: 23466246     BI number: BL1699     GOG: COG0477     Description: hypothetical transmembrane protein possibly involved in efflux transport Gene: fms     GI: 23466247     BI number: BL1700     GOG: COG0242     Description: polypeptide deformylas AT T  A A  G CG         a AT       t  t G  |      a  g GC        gt GC        cg GC        gc CG       |  a CG       |  t GC        at TA        cg TA        gc |  a       ta |  t      c  a G  c      t  | T  t      a  | Tg       A  | Gc       A  |        t Ta        Cg       a  t Cg        Gc        gc Gc        Gc        gc G  g      |  a       gc C  |       Cg        at A  |       Cg        cg Ta        Cg        cg At        Ta        gc Ta        Gt        at At        Gt        at                         ttttatgtcgaaacggaactcgacacgggcgcgcaggccgttgggtttgtctagagcctgcatatagttacttatggtaatgactattggtaactaaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here [J] COG0242 N-formylmethionyl-tRNA deformylase ... can be seen here     ..................................................................................................................