                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:205 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-22.10 kcal/mol
Antiterminator: Size=35 nt.     Delta G= -7.70 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G=-12.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGAGCGCTTCGCCGCCCTCAGCTGAgtcccacttactcagcctcggcgttaatcgcatcaagcgccattctgcccagtcgca
gaatggcgctttgttgtggataaccgaaacttatccacattcttaaaatttcaactgcgtcacagtatccacatttgccagttgcccttgtgcgcttcaa
acgtcatgcctcacagtggaggtaccgctggggcgtgcaagccggcaatgaagccggagacaggctccggcggtccacatccaaacaacaggccagcagg
ccgaggaaaggaccgatcATG

    BL1729 Gene: BL1729     GI: 23466274     BI number: BL1729     GOG: COG0629     Description: hypothetical protein with similarity to Ss            gc cg       c  a c  a      t  t at       a  c       ag gc       a  a      c  t |  A       ta       c  c |  T       tg        cg g  G       gc        gc a  c       cg        ta a  a       gc        cg a  g       gc        ta gc       c  a       ta gc       t  t       at at       c  t       cg gc       c  |       cg cg        gc        gc cg        at        cg gc        cg        gc                         tttgttgtggataaccgaaacttatccacattcttaaaatttcaactgcgtcacagtatccacatttgccagttgcccttgtgcgcttcaaacgtcatgcctcacagtggaggtaccgctggggcgtgcaagccggcaatgaagccggagacaggctccggcggtccacatccaaacaacaggccagcaggccgaggaaaggaccgatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0629 Single-stranded DNA-binding protein ... can be seen here     ..................................................................................................................