                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:33 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-18.30 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-12.20 kcal/mol
Anti-antiterminator:   Size=29 nt.     Delta G= -8.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTTGTTGGCGTGGCGGTGTATTTCTGCGTGATTTTGCCGATTAATAAGCTTCGTGAT
CTCACTGCTGCCCAGGATGAGGCTGACGCTGAAGAACAGGGGCCTAGCGTTGAAGAGC
AGACTCTCGCCACGCTGCAGGAGATTCGCGACGAGCTGAAAAAGGCCAATAACTCCGC
CGAGTAAtctgctgaatgtacggtgcgacagatttacctggtttgcccgaaataacggattgccggggccatttggtctggacaatccgttgttt
cgcgcgtgttttgtagcatccgtggagttacATG

    fadD4 Gene: fadD4     GI: 23466292     BI number: BL1748     GOG: COG1022     Description: probable long-chain-fatty-acid--CoA ligase; long-chain acyl-CoA synthetas            at           a  a           a  a            gc            cg            cg        tt           c  a      a  t tt       g  t       cg t  a      t  t       cg a  c      t  |      g  | gc        tg        gt at        gc        gc cg        gc        gt |  g       tg        cg |  t       cg        cg at        cg       |  a gt       a  g       gc cg       t  c       ta gc       t  c       ta t  |       ta        at gc        at        gc gc        gt        gc cg        at        cg                         ttgtttcgcgcgtgttttgtagcatccgtggagttacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG1022 Long-chain acyl-CoA synthetases (AMP-forming) ... can be seen here     ..................................................................................................................